ITP symptoms and treatment

ITP is a common hemorrhagic disease, causes complex, it is also more difficult for the capital Medical University School of Chinese Medicine of Beijing Medical subsidiary Gulou Chinese medicine hospitals Hall Primary ITP is a professional specialist in primary ITP treatment and research institutions, many of four treatment invalid ITP patients find here the hope of rehabilitation.

ITP is characterized by a significant reduction of platelet, with skin mucosa Purpura, who may have other serious bleeding sites such as nose bleeding, bleeding gums, women’s menstrual of excessive or serious vomit blood, hemoptysis, blood in the stool, and other symptoms Niaoxue , With intracranial hemorrhage is the cause of the disease died. Henoch-Schonlein purpura is characterized by skin limbs scattered spots or affect general, patients with severe joint pain or abdominal pain, blood in the stool, vomit blood, such as the collapse of serious cases can be developed for Purpura nephritis. ITP is divided into two categories of primary and secondary. Primary ITP is an autoimmune syndrome, is a common hemorrhagic disease. Is characterized by blood circulation in the anti-platelet antibodies, so that excessive platelet destruction caused purpura, and giant cells in the bone marrow of normal or more of the naive. Clinical acute and chronic can be divided into two, both pathogenesis and performance have significantly different.

Acute multi-for children under 10 years of age, no gender differences. More in winter and spring disease, before the disease has infected more than history, more respiratory infections, rubella, measles, chickenpox most; may also vaccination, infection and the incubation period purpura in more than one to three weeks. Adult acute-rare, often drug-related, than children with serious illness. Jizhou onset, fever.

Mainly for skin and mucous membrane bleeding, often more serious, skin was bleeding from the size of stasis, the uneven distribution to more limbs. Mucosa have epistaxis bleeding, bleeding gums, tongue oral mucosa Xuepao. Common digestive, urinary tract bleeding, bleeding under the eye of film, a small number of retinal hemorrhage. Common spinal cord or intracranial hemorrhage, can cause lower limb paralysis or performance of intracranial hypertension, can be life-threatening.

Chronic more common type of primary ITP of 80 percent, more than 10 to 40 years old, men and women for three to four times. Hidden passage of onset. Patients can have persistent or recurrent bleeding, and some local performance for the bleeding tendency, such as repeated epistaxis or menorrhagia. Stasis points and Yuban can occur in any part of the skin and mucous membrane, but the limbs to more remote. Will have gastrointestinal and urinary tract hemorrhage. Trauma may also appear deep hematoma. Intracranial hemorrhage rare, but in the event of acute attacks occur. Breathing deep in the spleen, even reach.

Primary ITP the etiology and pathogenesis, has not yet been clarified. And that is a more immune-related diseases.

At present western medicine treatment of ITP and allergic purpura is the preferred drug hormones, taken after the platelet generally increased, but the side effects of hormone very great increase in platelets at the same time will add many new diseases, such as concentric Obesity, hypertension, diabetes, osteoporosis, and hormone reduction, the platelet will be reduced, after stopping attacks will be repeated. Splenectomy risk of surgery, patients themselves difficult to accept. Spleen is the body’s immune organ, the splenectomy after the immunocompromised patients, easily lead to serious infections, to patients with physical and mental brought great suffering, the splenectomy after the relapse rate in 58 percent. Is there a method not only increased platelet, disease control, but also alternative hormone, the body will not produce side effects » National autoimmune disease experts, doctors Beijing Gulou Chinese medicine hospitals in Beijing Museum of primary ITP specialist founder Professor Jin Chu-lan mainly of the Group Based on years of clinical experience, with great concentration study, the use of early-model of the first principle of immunity The establishment of the integrity of the Chinese concept of immunology. The results stated ITP the pathogenesis.

Professor Jin Chu-lan was born in 1952 in Fujian She Nationality Chinese family, graduated from the Jiangxi College of Traditional Chinese Medicine. In the autoimmune disease treatment and research for nearly 30 years, keen to medicine, industry expertise in ground handling. Is the capital of the Gulou Chinese medicine hospitals Medical University (Beijing Medical Museum) experts, and as lupus erythematosus, director of the Institute of Dalian, Weihai bimodal director of the Institute of Chinese Medicine, director of the Chinese Society for Chinese Medicine, Chinese Society for Chinese Medicine Council of AIDS , Vice chairman of the China International Association for autoimmune diseases to health care professionals, chairman of the Committee, “capital of medicine” Magazine Editors.

Professor Jin Chu-lan, ITP is the pathogenesis of pulp, the onset of incentives (such incentives can come from both inside and outside) the stimulation, Ki-hang of Fu’s “pulp” to respond and produce a The whole concept of the viscera model to meet the changes. This pattern projector in a holistic manner to various body organs viscera. Rapidly, and form a new body, and when this status and further strengthen the “pulp” to stimulate the formation of a vicious circle. This vicious cycle of continued role in the body, so that pathological changes in the body, which showed systemic symptoms, skin Yuban or stasis, epistaxis, gingival bleeding, urine, menorrhagia, blood in the stool, cerebral hemorrhage, but also performance To the symptoms of anemia. This is what we said ITP.

Beware of children playing himself flu

Had common cold a few days later, still no rebate fever, cough and increased Nongtan, should pay attention to the mixed infection with acute bacterial bronchitis or pneumonia. Common cold, mostly due to a cold body, or from respiratory infections caused by viruses, often will not arouse people’s attention. But some seemingly cold and fever patients but can not be taken lightly, especially children. For these Bianlelian cold, it is timely to go to the hospital for inspection, so as not to delay treatment.

1. Had common cold a few days later, still no rebate fever, cough and increased Nongtan, should pay attention to the mixed infection with acute bacterial bronchitis or pneumonia.

2. Children in flu-like symptoms such as fever of 1 to 2 days, skin rash and blisters in the mouth, one should guard against varicella zoster virus infection caused by chickenpox.

3. After the fever in children 2 to 3 days, a skin-intensive small red papules, the pressure fade, while throat swelling, redness, enlarged tonsils, in the bright red tongue phenomenon, we should pay attention to in scarlet fever.

4. Children with a high fever three to four days later, in the cooling or heat Forward skin suddenly appeared pink papules, child care should be considered urgent measles.

5. Children in the event of fever, headache, sore throat and other “cold” symptoms of 1 to 2 days, a pink skin sparse distribution of the rash, or both ears after the pillow after lymph nodes should be considered when rubella.

6. Children in the event of fever, runny nose, cough and other “cold” symptoms in about three days, red skin rash, while the eyes photophobia, tears phenomenon, which may need to be a measles.

7. Children in the event of fever, headache, and other flu-like symptoms, the temperature has not dropped, while severe nausea and vomiting, and frequent seizures, should be suspected of suffering from diseases such as Japanese encephalitis or meningitis.

8. Children in the cold after a week of fever, if flustered, chest tightness, shortness of breath, heart discomfort and pain before District accelerated heart rate, irregular rhythm, the change should be alert for the possibility of viral myocarditis.

9. Children cold after cold symptoms of fever, also has sore throat, throat irritation, or a small white pus, and crying is not a meal, there may be suffering from acute tonsillitis.

10. Children of “cold” symptoms of fever, have nausea, vomiting, weakness, not the spirit of urgency and did not want to eat greasy food, and other symptoms, suspected to be infectious hepatitis.

Pneumonia see family

Winter is the season of high pneumonia, the medical experts therefore suggested that the elderly and the infirm pneumonia vaccine should be vaccinated in advance. However, human pneumonia is a big family, classified according to different pathogens, there are about 25 to 30 kinds, the treatment also varies.

■ viral pneumonia

Influenza virus pneumonia: assertive in the elderly, children and those with chronic diseases, high fever, exhaustion, irritability, theatrical cough, short breath, difficulty in breathing, ineffective antibiotic therapy, the mortality high. 9 annually, in October can be injected flu vaccine for prevention.

Adenosis toxic pneumonia: a predilection for six months to two-year-old infant, rapid onset, high heat, heat-long lethargy, languish and looking pale, white vomit mucus sputum, respiratory difficulties.

Primary varicella pneumonia: more common in adults and older children, light, silent, heavy have high fever, cough, chest pain, hemoptysis, and dyspnea and tachycardia, etc.. Injectable vaccine to prevent chickenpox.

Other viral pneumonia: infants and children, respiratory syncytial virus, parainfluenza virus, nose viruses, such as gastro-intestinal virus caused by pneumonia.

■ mycoplasma pneumonia

Often pneumonia accounted for 15 per cent of the total to 20 percent, the slow onset, fever, sore throat, severe intractable cough, fatigue, muscle pain or rash.

■ Chlamydia pneumoniae infection

Common because of the pneumonia accounted for the first three or four, the elderly, youth Most of fever and angina, sound mute,

■ bacterial pneumonia

Pneumococcal pneumonia: is the world’s most common bacterial suppurative pneumonia, often accounting for more than half of the total number of pneumonia. Sudden onset, a shivering, fever, chest pain, body muscle-ache, cough, cough rust colored sputum, and other symptoms, and if breathing difficult or gastrointestinal symptoms. Primary was particularly prevalent in males. Secondary was particularly prevalent in children, the elderly and those with chronic diseases. Penicillin preferred treatment, the prevention of immune 23-valent pneumococcal conjugate polysaccharide vaccine to protect up to five years.

Legionella infection: multi incidence in the summer and autumn, and often occur in the elderly and immunocompromised persons and chronic diseases. Processes high fever, chills, body muscle soreness, headaches, watery diarrhoea, nausea, vomiting, chest pain, dry cough, difficulty in breathing, and other symptoms associated with the nervous system. Treatment can be used erythromycin and rifampin or cyproterone scrapping Star.

Klebsiella pneumonia: often occur in middle-aged men, long-term alcohol in patients with chronic bronchial pulmonary disease, viscous sputum, a red brick, it is difficult Gaichu, some hemoptysis. Available cefazolin and gentamicin treatment.

Staphylococcus aureus pneumonia: multi-secondary, rapid onset, recurrent fever, chills, sweating, chest pain, dyspnea, cough, cough or Xietan purulent. Penicillin can be used or new cefalotin treatment.

Pneumonic plague and pulmonary anthrax: two very similar symptoms have chills, high fever, chest pain, cough, Xue Tan, difficulty in breathing. The former can be found in sputum plague bacilli; latter livestock and germ warfare agent anthrax exposure history, could be detected in sputum Bacillus anthracis.

■ other

Other pneumonia are anaerobic pneumonia, pulmonary fungal infections, Candida lung disease, pulmonary infection with AIDS (tuberculosis, Pneumocystis carinii pneumonia).

Understanding viral pneumonia

Viral pneumonia is caused by a variety of infections bronchial pneumonia.
Many viruses can cause bronchitis, a few can cause pneumonia. Infants and children is the most common respiratory syncytial virus, adenovirus, parainfluenza virus, influenza A and B viruses. In healthy adults, the only common the viral pathogens is A, influenza B virus. sometimes, adult viral pneumonia can be adenovirus, chickenpox - zoster virus, Epstein-Barr virus, Coxsackie virus and Hanta virus. elderly are important pathogens the influenza virus, parainfluenza viruses and respiratory syncytial virus. impaired immune cells from patients often latent virus, especially cytomegalovirus (CMV) or herpes simplex viral lung infection. Furthermore, the majority of infections due to non - the immunity contact with the pathogens caused by the people.

Pathological changes

The virus penetrated thin bronchial epithelial caused bronchiolitis, the infection can be broadcast interstitial and alveolar lung caused pneumonia. Congestive lesion site, and sometimes bleeding from mononuclear cells in the strong participation of the inflammatory response. Alveolar fibrin content within alone nucleated cells, occasionally, polymorphonuclear leukocytes. serious cases, a transparent membrane. adenoviruses, cytomegalovirus, respiratory syncytial virus, or chickenpox - zoster virus can see characteristics of the cells with the virus within inclusion bodies.

The main clinical manifestations

Most of the patients have headaches, fever, muscle pain and mucus purulent sputum with the cough.
1. Slow onset, headache, fatigue, fever, cough, cough or a small number of present phlegm, symptoms generally lighter.
2. Immunodeficiency patients, and the illness was more serious, sustained high fever, palpitation, dyspnea, cyanosis, extreme exhaustion, can be associated with shock, heart failure and azotemia.
3. Chest signs less, there are limitations of a small amount of breathing and the sound weakened wetlands Romanian Music.

Diagnosis

1. Will occur in winter and spring, the outbreak or epidemic can be distributed. 2. Onset slow, often accompanied with upper respiratory tract infection, persistent dry cough. Lung signs less. 3. Normal blood leukocyte count, lower or slightly higher. 4. Etiology inspection: Virus Isolation: sputum or isolated virus; removed respiratory secretions or lung biopsy specimens isolated virus; respiratory secretions of inclusion bodies in the nuclei can be suggested that the virus infection. Serological examination: Complement combination test, hemagglutination inhibition test, and test specific IgG antibodies in serum; immunofluorescence assay, ELISA and RIA detection of the virus in serum IgM antibody specificity. Virus detection and viral antigens: Remove respiratory secretions or lung tissue biopsy specimens, found cells by light microscopy within inclusion bodies; electron microscope using immunofluorescence assay respiratory secretions or exfoliated cells in the lung tissue of virus antigen. 5. Chest X-ray examination-see spots, patchy or uniform shadow on both sides was particularly prevalent in the next 2 / 3 lung field. Pleural rarely involved. 6. Antibiotic treatment ineffective.

Therapeutic Use principles

Treatment principles
1. Mainly symptomatic treatment, prevention and treatment of secondary bacterial infection. 2. Antiretroviral treatment. 3. Strengthen support therapy. 4. Treatment complications.
Medication principle
1. General cases mainly to symptomatic treatment, cough expectorant and added all kinds of vitamins and other complementary medicine. Ling virus can be oral or ribavirin. 2. Severe cases mainly by intravenous medication, therapy and support to prevent complications. Treatment under conditions corresponding extension. 3. Merger bacterial infections, according to clinical and sensitivity test to choose effective antibiotics.

Drug Treatment and Evaluation

Drug therapy
To have herpes simplex, or varicella zoster infection of the lungs, generally advocate the use of acyclovir, adult 5 ~ 10 mg / kg every 8 hours 1st, or children 250 mg/m2 body surface area every eight hours 1st . in organ transplant recipient, cytomegalovirus pneumonia can be used ganciclovir 5 mg / kg intravenous injection two times a day, and the use of immune globulin (intravenous immunoglobulin or cytomegalovirus immune globulin). this treatment of AIDS patients had no significant effect (prevention and treatment of influenza in section 162 of influenza in the discussion).
Some patients, particularly influenza patients, such as the merger of bacterial infections require antibiotic treatment. Common pneumococcal is the main pathogens and Staphylococcus aureus, followed by the Haemophilus influenzae, A β - hemolytic streptococcus and Neisseria meningitidis cocci. pathogenic microorganisms, patients of different age and complications, prognosis also is greatly different. treatment based on pathogens may be.
Evaluation
1. Cured: symptoms, signs disappear, X-ray showed lung shadow completely absorbed. 2. Turn for the better: symptoms, signs disappeared, the shadow of the lung absorption. 3. Surprised me: symptoms, signs or no obvious changes deterioration of pulmonary lesions not absorbed or deterioration.

Preventive measures

Virus antibodies later, the infection control is very limited. Interferon on susceptible cells infected with the virus has a protective effect, prevent disease and prevent its spread development role. Cellular immune control on the role of a virus, such as leukemia or Hodgkin’s disease cellular immune defect, it is easy to feel a measles and chickenpox virus, and no other virus susceptibility. The current domestic already widespread inoculation of infants live attenuated measles vaccine, measles has now extremely rare, measles pneumonia even rarer.
Human immunoglobulin passive immunization on the susceptibility of patients, especially against chickenpox and measles have a protective effect. Specific vaccination on influenza, adenovirus, such as measles despite protective effect, but not completely prevent attacks.

Genital herpes diagnosis and differential diagnosis

HSV infection to the diagnosis based on history, clinical performance and laboratory test results may be. A history of dirty sexual intercourse, and genital parts in a primary blisters and skin erythema, it is not difficult to diagnosis, and so easy to relapse. If necessary, can be used for blister fluid smears, nurturing, Vaccinations, immunofluorescence inspection. Determination of serum immunoglobulin antibody, among other things, help to diagnosis and determine the virus type.

First, cytology method

The films do lesions scraping Wright-Gemsa (Tzanck test) or Papanicolaou stain, HSV detection of cytomegalovirus infection characteristics of packet letter, but HSV infection or chickenpox - zoster virus infection, the sensitivity was only virus isolation 60 percent.

Second, culture

Bottom from blisters to do tissue culture based separation virus, for the present more sensitive and specific method, takes 5-10 days because of technical conditions and high requirements, which is very expensive, not widely used. Third, antibody detection

Now is the most widely HSV-2 antibody detection, such as the Western blot method could also be used gD2 for antigen detection of HSV-2 antibodies, sensitive, and can distinguish between HSV-1 and HSV-2 advantages.

Fourth, genetic diagnosis

(1) using PCR detection of herpes simplex virus type

PCR is a highly sensitive and specific method for rapid detection, the samples containing 1 fg HSV-DNA can be detected, in the diagnosis of HSV infection in the development of faster, and the type of HSV is the development trend.

1, specimen collection and processing

(1) Sampling

① CSF: Aseptic taken directly cerebrospinal fluid specimens with 0.5 ml in sterile test tube submission. Such as visible blood, should take centrifugal supernatant.

② infant serum and amniotic fluid: Ditto, should avoid hemolysis.

③ brain tissue: brain autopsy, biopsy specimens, plus 1 ml PBS specimens buffer after grinding, to be seized.

④ eyes and skin lesions secretions: Forecast (Semi-) cotton swabs directly from secretions, Purchase 1 ml in PBS buffer were submitted.

⑤ genital (cervix, vagina, vulva, penis) specimens: to use cotton swabs wipe disinfection diseased surface mucus, dirt, and then forced the PWC tidal cotton swabs wipe secretions, Purchase 1 ml in PBS buffer send specimens the seizure.

(2) handling specimens

① pretreatment: All liquid samples can be directly template preparation; can take 100 µ l sample fluid, centrifugal 5000 r / min × 5min after the supernatant to collect sediments of a template.

② template preparation: a: proteinase K digestion lysis method: sediments and 100 μ l proteinase K digestion lysis, 55 ° C for 1 h after boiling for 10 min, centrifugal 5000 r / min × 5 min, the supernatant collected. B: boiled Law: sediments and 100 μ l distilled water, shaking were boiled for 20 minutes, centrifugal 5000 r / min × 5min collection of the supernatant. C: 1% Triton X-100 lysis method: Specimens collected from liquid 100 μ l, 1 μ l Triton X-100, boiled for 20 minutes, 5000 r / min × 5 min, the supernatant collected. D: 5% NP-40 lysis method: Specimens collected from liquid 100 μ l, plus 5 μ l NP-40, boiled for 20 minutes, 5000 r / min × 5min collection of the supernatant. E: If serious hemolytic specimens processed by the above cracking, coupled with volume phenol - chloroform extraction and ethanol precipitation cold DNA, plus 10 μ l dissolved question DW seized.

2, PCR amplification

(1) primer design. HSV DNA polymerase to the high detection target for the conservative region to ensure that the sequence specificity. Design three primers, a common upstream primer, DNAP5 (5′ATGGTGAAAACATCGACATGTACGG3 ‘): two downstream specific primers, DNAP3-1 (5′CCTCGCGTTCGTCCTCGTCCTCC3′) and DNAP3-2 (5′CCTCCTTGTCGAGGCCCCGAAAC3 ‘), respectively, can be amplified .

(2) PCR experimental system. Admission template 10 μ l: DNAP5 0.5 (0.2 µ mol / L): DNAP3-1 0.5 μ l (0.2 µ mol / L): DNAP3-2 0.5 μ l (0.2 µ mol / L): 4 × dNTP 8 μ l (4 × 200 μ mol / L): 10 × dNTP 8 μ l (4 × 200 μ mol / L); 10 × buffer 10 μ l: DMSO 4 μ l; plus DW 65.5 μ l; paraffin oil 30 μ l..

Boiled (96 ° C to 100 ° C) 7 min
Plus TaqDNA polymerase 1 µ l; (2.5U)
72 ° C for 4 min
↓
95 ° C for 40 s
↓
65 ° C for 60 s → 72 ℃ 70 s
↓ 33 cycle
70 ° C for 4 min

3. The amplified product testing and analysis

(1) agarose gel electrophoresis staining: from amplified products 20 μ l plus sample buffer 4 μ l blending, point-like at 2% agarose gel plate, 70 V electrophoresis 15 ~ 20 min, ethidium bromide (EB ) staining for 5 min, the results observed in the UV lamp source in BPB behind with a bright red belt or two for positive results, the former HSV-2 zone, HSV-1 zone in the latter, compared with no negative results.

(2) XhoI enzyme spectrum: from HSV-1 PCR product of 50 μ l increase XhoI50U, 37 ° C for 1 h after the home 3% agarose gel, 70 V electrophoresis 15 ~ 20 min, with a 46 bp fragment (primer behind); compared with normal PCR products, digested big XhoI fragment electrophoresis position advancement.

(3) Southern blot: PCR product of 20 μ l after separation by electrophoresis, using denaturing solution for 60 min, and then in the liquid for 90 minutes and transferred to nitrocellulose membrane: 80 ° C bake membrane 2 hours, 42 ° C pre-Hybrid (hybrid solution) for 30 min, by adding 32 p marker HSVP3 probe, 42 ° C hybridization overnight; the next day with 1% SDS / PBS pH7.2, 42 ° C washing for 15 min, 0.5% SDS / PBS pH7.2, 42 ° C wash 15 min; home X-ray film cassette with radioactive autoradiography 12 ~ 15 h, positive image, the image is not negative.

(B) nested PCR

Nested PCR (nested primers-polymerase chain reaction, NP-PCR) through “lateral”, “inner” two pairs of primers, one pair of large DNA fragments amplified the “lateral” and one pair of primers in the expansion production of small fragments amplified again in the “medial” primer, so two consecutive PCR amplification can improve the sensitivity, specificity product guarantee. But this method can not type, can be 100% detection of HSV-1, 50% detection of HSV-2, should improve the detection of HSV, and better in basic research and clinical application in the application.

1, specimen handling:

(1) Sampling Ibid.

(2) DNA Preparation: ① CSF: from 100 μ lCSF boiled for 15 min, by adding 250 μ l ethanol, caving -30 ° C for 10 min; centrifugal 10000 g30 min to the supernatant, 30 ° C after drying, by adding 10 μ l DW; ② brain cells : from sediments and 100 μ l proteinase K digestion lysis, and 56 ° C for 1 h, boiled for 10 min; join the supernatant from a phenol chloroform volume (V / V),轻摇10 min, centrifugal 10000 r / min x 10 min ; water phase by adding 250 μ l DW dissolved.

2, PCR amplification

(1) primer design: choose HSV1 glycoprotein D gene for the detection of target gene.

NP-PCR primers and probe sequence

, “” Primer
BJHSV1.1 ATCACGGTAGCCCGGCCGTGTGACA 19-43
BJHGV1.2 CATACCGGAACGCACCACACAA 218-239
“Primer”
BJHSV1.3 CCATACCGACCACACCGACGA 51-79
BJHSV1.4 CGTAGTTGGTCGTTCGCGCTGAA 166-188
Probe
BJHSV - 1PRO TACGAGGAGGAGCTGTATAACAAAGTCTGT 96-125

(2) PCR experimental system and procedures: reaction volume of 50 μ l; template 10 μ l; BJHSV1.1 0.5 μ l (0.2pmol / L); BJHSV1.2 0.5 μ l (0.2pmol / L); 10 × buffer 5 μ l; 4 × dNTP 4 μ l (4 × 200mmol / L); DW 27 µ l; paraffin oil 30 μ l. Cycle parameters of 95 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 60 s; circle 20 times, select the amplified products 1 μ l join contain BJHSV1.3 and BJHSV1.4 reaction system of nested PCR, the first 95 ℃ degeneration 2 min cycle parameters of 95 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 60 s; circle 30 times, 72 ° C extended 5 minutes.

(3) analysis of PCR products:

① stained agarose gel electrophoresis method:

Admission amplified products 10 μ l sample was 2% agarose gel, 70V electrophoresis 15-20 min, ethidium bromide staining for 5 min, the results observed in the UV lamp source, Bromophenol behind with a Portland, or 102 of the bright red with positive results, the former HSV-2 zone, HSV-1 zone in the latter, compared with no negative results.

② Southern blotting:

PCR products were 20 μ l after separation by electrophoresis, using denaturing solution for 60 min, and then in the liquid for 90 minutes and transferred to nitrocellulose membrane, 80 ℃ bake membrane 2 hours, 42 ° C pre-hybridization (hybrid solution) for 30 min, by adding 32 P HSV labeled probes, 42 ° C hybridization overnight, the next day with 1% SDS / PBS pH7. 2,42 ° C washing for 15 min, 0.5% SDS / PBS pH7.2, 42 ° C washing for 15 min; home X-ray film cassette, radioactive autoradiography 12-15 h, and for the positive image, the image is not negative.

(C), polymerase chain reaction - zymography (polymerase chain reaction-endonuclease cleavage PCR-EC)

A wide economic characteristics can not only detect one type HSV-1, HSV-2, EBV, CMV four viruses, but their methods rapid, convenient and no radiation injury, easily laboratory acceptable. May detection three CFU of HSV1, high sensitivity, central nervous system can detect infection in section 1 dCSF HSV DNA positive results for drug treatment and evaluation. Because of the variability of the virus, there will be digested point mutation lost, thereby causing digestion negative results. This can type or sequence analysis of specific probes to resolve.

1. Handling specimens

(1) specimen collection, methods Ibid.

(2) Preparation of DNA template: Each specimens from 200 μ l, by 200 μ g / ml proteinase k, and 56 ° C for 1 h;

Join the volume of phenol - chloroform (v / v) centrifugal 1000 r / min × 5min; water phase by adding 500 μ l (2.5 times the volume) ethanol, -20 ° C overnight precipitation DNA, centrifugal 15000 r / min x 5 min, to suction liquid, 30 ℃ drying, and distilled water 25 μ l dissolved, to be seized.

2. Primer design:

P1, 5′CGACTTTGCCAGCCTGTACC3 ‘

P2, 5′AGTCCGTGTCCCCGTAGATG3 ‘

(1) PCR experimental system:

Reaction volume 100 μ l; template 10 μ l; P1 0.5 μ l (10pmol / L), P2 0.5 μ l (10pmol / L); 4 × dNTP 4 μ l (4 × 200mmol / L); 10 × buffer 10 μ l, DMSD 5 μ l, DW 65 μ l, recycling parameters of 94 ° C for 60 s, 60 ° C for 60 s; 72 ° C for 60 s; cycle 40 72 ℃ extension 4 min.

(2) Detection and digested PCR products typing.

① first step electrophoretic analysis: from 10 μ lPCR product plus 4 μ l sample buffer, by adding 2% agarose gel plate, 70 V electrophoresis (5-20 min) and EB staining for 5 min, UV lamp source observation, a preliminary identification of amplified products Size.

② digestion analysis: respectively from 20 μ lPCR product of the two Eppendorf tube, by adding 50 μ l ethanol, -20 ° C precipitation DNA, respectively with 20 μ lSmal BamHI reaction buffer and dissolved by adding SmaI or BamHI 50U in the corresponding Eppendorf tube, 37 ° C for 1 h.

③ second electrophoresis typing, from 10 μ lPCR digestion of plus 4 μ l sample buffer, added to 2% agarose gel, 70 V electrophoresis 15-19-20 min, EB staining for 5 min, and the simultaneous accession to the digestion PCR products were compared. UV lamp source observation, the results are as follows:

PCR-EC virus was detected four results

Virus Model target fragment SmaI BamHI
HSV1 518bp 476bp +42 bp
HSV2 518bp - 225 +293 bp
EBV 524bp 100bp +424 bp 277bp +247 bp
CMV 589bp without restriction, the first step on the electrophoresis can be distinguished

(4) detection by RT-PCR of herpes simplex virus

RNA polymerase chain reaction (RNA-PCR), may adopt different phase of HSV detection of RNA, which can not only diagnosis of HSV infection, but also conducive to the incubation period HSV infection mechanism of in-depth study.

RT-PCR on RNA as a template by reverse transcription reaction (RT) cDNA generated, then cDNA as template for PCR amplification to achieve the purpose of detection. Thus, RNA-PCR can also be called RT-PCR.

1, specimen handling:

Organizations block total cellular RNA extracted from 100 mg tissue, plus 1 ml degeneration of guanidine thiocyanate, in a homogenate, the grinding room temperature uniformity, the inflow 2.5 mlEppendorf tube. Followed by adding 0.1 ml3mol / L (pH4.0) NaAc, 1ml water-saturated phenol and 0.2 ml chloroform - isoamyl alcohol blending a force, home ice bath for 15 min. 10000 g4 ℃, centrifugal 20 minutes from the water phase (upper DNA, and DNA denaturation lower protein) by adding volume isopropanol home -20 ° C for 1 h, precipitation RNA. Centrifugal 15000 r / min × 10min, disposable supernatant, RNA re-guanidine thiocyanate with 0.3 ml of dissolved degeneration, coupled with 0.3 ml isopropanol precipitation, -20 ° C for 1 h, precipitation RNA. Centrifugal 15000 r / min × 10min to the clearly, precipitation RNA with 75% cold ethanol washing once, vacuum drying. . Plus 10 μ l TE buffer solution (pH7.4) dissolved, cryopreservation standby. Council dissolved by the former ice bath.

2, PCR amplification:

(1) primer design: choose HSV-1ICPO gene (very early) for the detection of target gene. Design two primers,

P1 5′GGATCCTCACGTGGTTACCCGCGGTCT 3 ‘

P2 5′AAGCTTCCGGGGCCGTCCCCGCGGGCG 3 ‘can be amplified in the 266 bp sequences ICPO.

A probe: 5 ‘CCGGCTGGAGCCGCCGCACCCTGCT3′.

(2) PCR experimental system: the total reaction volume was 50 μ l, template 10 μ l (0.25-1.0 μ g) P1 1 µ l (20pmol / L); P2 1 µ l (20pmol / L); 4 × dNTP 4 μ l (200 μ mol / L); 10 × buffer liquid 5 μ l; AMV (reverse transcriptase) 2 μ l (50U); DW 26 μ l; cycle parameters, 94 ℃ degeneration 2 min 94 ° C 50 s, 60 ° C 60, 72 ° C for 60 s, cycle 40 after 72 ° C extended 5 min.

3, the identification of amplified products:

(1) agarose gel electrophoresis staining: from 10 μ l PCR products plus 4 μ l sample buffer, blending after sample 2% agarose gel plate, 70 V electrophoresis 15-20 min, EB stained 5 min. UV lamp source observation amplified bands.

(2) Southern blot hybridization: 32 P labeled probes specific detection of PCR products, methods Ibid.

In short, in HSV infection of the clinical diagnosis of the disease, before the virus can PCR or low latency of HSV replication target specific amplification of DNA fragments than DNA probe sensitive, and serum antibody can be pre - the detection. Thus, PCR is both basic research tools, or as a clinical laboratory diagnostic methods, both have broad prospects.

5. Histopathological diagnosis

Cells edema, basal layer large blisters formed, how nuclear lesions around giant cell infiltration, in particular the multi-core flooding in leukocyte and lymphocyte lesions middle.

Differential diagnosis

With hard chancre: mainly, chancroid identification: the hard chancre: quality hardware for the single ulcer, no pain, no relapse history, laboratory examination USR (+) or RPR (+), Treponema pallidum visible. Chancroid soft for the quality of ulcers, although local recurrence pain without the history, laboratory examination chain was positive.

Other sites skin diseases such as genital herpes zoster contact, Behcet’s disease. Pustule sometimes with genital herpes similar, from the history and examination of the distinction.

Syphilis laboratory

Previous laboratory tests have Treponema pallidum inspection, syphilis test serum and cerebrospinal fluid examination. With the development of gene diagnosis technology, PCR technology applications of DNA testing Treponema pallidum, the syphilis diagnosis become accurate, rapid and sensitive.

First, Treponema pallidum inspection

(1) inspection methods

1. Dark-field microscopy: skin lesions, using slide organizations exudative fluid or lymph node puncture fluid, see that the activities of Treponema pallidum.

2. Immunofluorescent staining: green fluorescence microscopy showed the Treponema pallidum.

3. Biopsy examination Treponema pallidum, such as silver staining (Warthin - starry) Act, or (Levoaditis Act) or fluorescent antibody staining, available on the see Treponema pallidum, a dark brown, spiral structure, located in the surrounding dermal capillary. Silver stain positive results have to be interpreted cautiously because similar Treponema pallidum of other substances easily confused. While specific fluorescence tests were more reliable. (B) Identification of spirochetes

Endoscopic examination Treponema pallidum and Yaws, endemic syphilis, for his three non-venereal spiral of identification, and the tooth should also be of great spiral, helical gear of the small, soft spiral body, the spiral of genital phase identification.

1. Yaws, endemic syphilis, for his three non-STD spirochetes: morphology and Treponema pallidum not distinguish, but epidemiology, medical history, clinical manifestations can be identified;

2. Teeth of the spiral: reduced spirochetes than Treponema pallidum longer exists in the oral cavity, particularly the largest in Chifeng;

3. Tooth small spiral of: shorter than Treponema pallidum, Rotary also short distance, irregular movement at both the central slightly more width. Scale were seen mainly in the tooth; 4. Soft spirochetes: dredging of the spiral, spiral less, sports law and not fast, often changing its shape. The parasitic skin ulcers.

5. Genital spirochetes: short than Treponema pallidum, the spiral of big without rules, born in overcast dirt, not regular cleaning to a higher detection rate.

6. Other: spiral-shaped mesh fiber, fiber protein filaments, cilia, string-cell, and other objects of a spiral differential.

Second, syphilis serum test

According to different antigen used, syphilis serum test is divided into the following two categories:

(A) Non-Treponema pallidum serum antigen test motives for phospholipid antigen in the serum of anticardiolipin antibodies, also known as Su-reaction. This high sensitivity and specificity test lower, it can easily happen biological false positive. Patients with early syphilis fully after treatment, the reaction-can disappear without treatment early to late in the reaction of some patients may also be reduced or disappear. As the current general screening and quantitative tests, observation of relapse and re-infection. 1. Sexually transmitted diseases research laboratory test (Venereal Disease Research Laboratory test, VDRL); intentions phospholipid, lecithin, and cholesterol as antigen, can be used for quantitative and qualitative tests, reagents and control serum has been standardized, low-cost. This method commonly used, simple operation, preparing microscope to read the results, the deficiency is a syphilis sensitivity is not high.

2. Quick-reaction test plasma (Rapid Plasma reagin test, RPR): VDRL antigen improved sensitivity and specificity and VDRL similar advantage is the naked eye can read out the results.

3. No heating of glass test seropositive (Unheated Serum Reagin USR) is also VDRL antigen improved sensitivity and specificity and VDRL similar.

(B) Treponema pallidum serum antigen test: living or dead Treponema pallidum or their components to make spiral of antigen-antibody determination. This test sensitivity and specificity are high, generally used to confirm test. This test is to test anti-serum IgG antibody Treponema pallidum, even after adequate treatment of patients still exist for a long time, even lifelong not disappear, serum continued existence of positive reaction, therefore, can not be used to observe the effects.

1. Fluorescence Treponema pallidum antibody absorption test (FTA-ABS Test): This method is more sensitive and specific than the helical body experiments.

2. Treponema pallidum hemagglutination test (TPHA): sensitivity and specificity are high, easy to operate, but on a syphilis test as FTA-ABS sensitive.

3. Syphilis system dynamic test (Treponema Pallidum immobilization, TPI); spiral of strains with Nichol (live) plus serum (containing antibodies), in meeting with the participation of inhibited spiral of events. If ≥ 50% Treponema pallidum stop their activities, compared to positive. This test specificity and sensitivity are high, but high equipment requirements, operational difficulties, only research.

Third, gene diagnosis technology detection Treponema pallidum

Treponema pallidum not conducted in vitro. Clinical specimens of Treponema pallidum in the most sensitive and reliable test method is infected rabbits (RIT), live RIT can prove the existence of Treponema pallidum, the syphilis testing is commonly used standard methods. But with RIT on neonatal or adult conventional diagnosis of syphilis is not realistic. Syphilis serology diagnosis and treatment of infections identified significant, but not sensitive to the early diagnosis of syphilis, congenital syphilis and the diagnosis of nerve enough specificity. Serological tests for the diagnosis of congenital syphilis, the first problem is to be asymptomatic infected babies from the non-infected babies separately, these baby’s mother serum test positive syphilis, the difficulty lies in not humoral immune response to mothers with babies antibody response phase difference, because the mother’s IgG can be passed to the fetus. Also due to the existence of IgG life, it is difficult to evaluate the treatment results. Serological diagnosis often time, there is the false positive.

PCR Treponema pallidum DNA, highly specific, high sensitivity, is the diagnosis of syphilis in advanced methods.

(1) the design of PCR primers location and sequence:

At present, there are four sets of Treponema pallidum DNA amplification systems: Amplification 47 KDa membrane antigen gene (tpp47 gene), amplified 39 KDa alkaline membrane protein gene (bmp gene), amplified TpF1 protein gene (tpf-1) or TyF1 protein gene (tyf-1) and gene amplification tmpA.

Three amplification system primer sequence:

47-1 CACAATGCTCACTGAGGATAGT 648-669

47-2 ACGCACAGAACCGAATTCCTTG 1284-1035

Tpp47-3 TTGTGGTAGACACGGTGGGTAC 713-734

47-4 TGATCGCTGACAAGCTTAGGCT 1187-1208

TP3 CAGGTAACGGATGCTGAGT 256-275

TP4 CGTGGCAGTAACCGCAGTCT 762-741

BmpTP5 (probe) GACCTGAGGACTCTCAAATC 500-519

TP7 CTCAGCACTGCTGAGCGTAG 172-191

TP8 AACGCCTCCATCGTCACACC 788-769

F1 CTCTTCAAGGAGCTCAT 222-206

Tpf - 1F2 AGACAGTGGTTATGCTC 77-61

Or tyf - 1F3 (probe) ATTGCGCCAGCATGTAG 114-130

F4 (probe) ATTGCGCCGGCATGTAG 114-130

(B) the methods of operation

1. The collection of samples, according to the patient’s condition may take partial discharge, collected lymph node fluid, amniotic fluid, serum and cerebrospinal fluid. Distilled water with proper dilution, stored at 4 ° C refrigerator.

2. Sample handling: purpose is to expose the DNA Treponema pallidum, the elimination of specimens of PCR inhibitors. The following approach.

① boiling method: take 10 or 20 μ l serum or CSF Add 0.5 ml micro centrifuge tube, the water bath in boiling 10 minutes after cooling in the ice bath, 13000 g centrifugation 10 s, the supernatant for PCR analysis.

② low speed centrifugation: 100 μ l amniotic fluid, serum or cerebrospinal fluid into the 900 μ l sterile phosphate buffer, 10000 g centrifugation 10 min at room temperature, the supernatant was transferred to another microcentrifuge tube, 20000 g4 ℃ centrifugal 1 h, The supernatant was removed, suspended sediment 50 μ l sterile water, direct boiled for 10 min, ice bath cooling, supernatants from 40 μ l for PCR.

③ alkaline lysis method: take specimens 100 μ l collection in Canada with 1 mol / L NaCl, 1mol / L and 0.1% SDS NaOH solution in boiling 1.5 min, with 400 μ l (0.5 mol / L), Tris-HCl (pH 8.0) and . With the same volume of phenol extraction, then to 100 μ l 0.15mol / L NaCl phenol extraction. The entire 600 μ l solution with the same volume of chloroform: isoamyl alcohol (24:1) extraction, and then use the same volume of isopropanol precipitation (-20 ° C too fluid). 13000 g4 ℃ centrifugal 15 minutes, Along amylin suspended in 51 μ l sterile water, from 20 μ l as PCR template.

(C) PCR Amplification

1. Amplification 47 KDa membrane antigen gene: 100 ml of reaction of: 10 mmol / L TrisHCl (pH8.3), 50mmol / L KCl, 3mmol / L MgCl2, 100 μ g / ml gelatin, 0.5 μ g primer (47-1 and 47-2) , 75 mmol / LdNTPs, 2.5U TaqDNA polymerase. Preparation of various different from the DNA as template, the reaction process: 94 ° C 15 s, 60 ° C for 1 min, 72 ° C for 1 min, cycle 40, the end of the cycle to increase 72 ° C for 10 min extension of time, from 10 ml of reaction by 1% agarose gel Electrophoretic analysis. Dot blot analysis product: from 10 mlPCR amplified products by adding 10 ml0.5mol/LNaOH-1.5mol/NaCl solution degeneration 10 min, with 380 μ11.5 mol / L NaCl - 1mmol / L Tris (pH 7.2) and then use Minifold I point Films, 80 ° C vacuum processing film for 2 h with 496 bp probe 65 ° C hybridization overnight. Probe for primer 47-3 and 47-4 the PCR product with random primer labeling.

2. Amplification 39 KDa alkaline membrane protein gene: 25 μ1 reaction system including: 1 × RT buffer, 50 mmol / L Tris-HCl (pH 8.5), 50mmol/LNaCl, 4mmol/LMgCl2, 2mmol / L DTT (Kisumu sugar disulfide Alcohol), 200 μ mol / L dNTP, 100 µ mol / L primer (TP7 and TP8), 0.01% bovine serum albumin (no DNase and RNase), 1UTaqDNA polymerase, 5 μ1 sample, which may be included in 0.05 mmol / L 4-chloro enhance methylamine PCR.

PCR1: by using primers TP7 and TP8 amplified a 617 bp fragment, the reaction process: 94 ° C for 3 min and entered the cycle of: 94 ° C for 1 min, 65 ° C for 1 min, 72 ° C for 1 min, cycle number 30 or 35, each cycle of 72 ° C extension increased by 5 s, the last extension of time to 6 minutes.

PCR2: reuse nesting primer TP3 and TP4 amplified a 500 bp fragment, PCR1 product with distilled water diluted by 10 times, from 5 μ1 for the second time amplification. PCR2 of MgCl2 and primer concentrations of 5 mmol / L and 20 μ mol / L primer ( TP3 and TP4), and other conditions and PCR1 same.

PCR products were analyzed. ① from 10 μ1 reaction products by 2% agarose gel electrophoresis; ② Southern blot, using oligonucleotide probes TP5 (32P for end labeling) hybridization.

3. Amplification TpF1 protein gene TyF1 protein gene: 100 μ1 reaction containing: 50 mmol / L KCl, 10 mmol / L Tris-HCl (pH8.4), 2.5mmol / L MgCl2, 0.2mg/ml gelatin, 1 µ mol / L dNTP, 2mmol / L primer (F1 and F2), 2.5UTaqDNA polymerase, 10 μ1 treated rabbits testicular Treponema pallidum suspension, the reaction process: 94 ℃ 1min, 55 ℃ 1.5min, 72 ℃ 2.5min, cycle 40 times, from 10 μ1 PCR products used 2% agarose gel electrophoresis, Southern blotting, with tpf-1-specific probe F3 and tyf-1 special foreign body hybridization probes F4, respectively.

To achieve maximum efficiency amplification reaction parameters should choose the best value. Use the double-stranded DNA probe fragment detection of PCR products, rather than synthetic oligonucleotide probes, as this can be labeled high specific activity of radiation. In addition, the largest fragment probe can reduce wild strains tpp47 variable sequence and false negative results due to the Taq DNA polymerase base substitution errors led to the false negative results. Experiments confirmed: PCR can really achieve the sensitivity of detection tpp47 copy level.

Because clinical samples may contain a large amount of personnel cells and microorganisms, the establishment of Treponema pallidum highly specific PCR method is very important. Despite the large number of As noted in support of 47 Da membrane antigen gene and its corresponding gene with Treponema pallidum specificity, but also in-depth study of the specificity of the method. In EB stained agarose gel occasionally visible non-specific PCR products, (such as amplification gonorrhea Nyquist cocci), on the need for tpp47 specific probe hybridization to increase the specificity and sensitivity. Only Treponema pallidum subspecies of syphilis and Yaws subspecies of chromosomal DNA obtained specific PCR products, show that the pathogenic spirochetes very close relationship and 47 Da immune highly conserved protein antigenicity. Amplification tpp47 not as if the conventional method can distinguish between syphilis and of Borrelia burgdorferi, using serological tests in the diagnosis of Lyme disease and syphilis, there are two spiral cross-reaction.

Treponema pallidum subspecies of syphilis tpf-1 gene in 123 locations A, Yaws subspecies tpf-1 gene in 123 locations for G, Noordhoek with tpf-1 or tpf-1-specific oligonucleotide probe (two probes only one nucleotide different) testing different strains tpf-1 or tpf-1 gene amplification product. The results show that: it can not tpf-1 or tyf-1 gene 123 locations nucleotide difference between syphilis to the different subspecies. These strains isolated from patients with syphilis, some have spent several rabbits passage through the fresh clinical specimens Treponema pallidum DNA analysis and comparison, the above results may be due to Treponema pallidum in the passage by the mid-point mutation.

4, cerebrospinal fluid examination

For the diagnosis of syphilis nerve, including cell count, protein, VDRL test, PCR, colloidal gold test. Neural asymptomatic except for syphilis, all syphilis patients who period of more than one year should be for cerebrospinal fluid examination. Early Congenital Syphilis all babies should also check with the exception of cerebrospinal fluid of the central nervous system involvement may be. Cerebrospinal fluid cell count and the total protein amount of the increase in non-specific changes in neural CSF VDRL test is a more reliable diagnosis of syphilis basis. However, when the activities of the presence of syphilis, CSF white blood cell count often increased (WBC> 5/mm3), it also CSF white blood cell count is often a sensitive indicator of judgment. Conditional CSF PCR units will be fast and accurate diagnosis of syphilis nerve.

5, syphilis false positive serum reaction

Technical false positive: high sensitivity antigen, serum specimens made a mistake or hemolysis or bacterial contamination, the inspection room technology unskilled.

Biology false positive: spiral of non-antigen positive rate higher than the serum test spiral of serum antigen test. The former is to test the response of the patients, which is to test anti-Treponema pallidum antibody. The spiral of non-antigen test used also exist in other organizations, so other diseases have emerged even occasionally normal reaction of, in certain diseases occurred positive reaction against syphilis case called false positive.

1. Acute biological false positive: these diseases in the six months to overcast.

Seen measles, chickenpox, rubella, infectious mononucleosis disease, upper respiratory tract infections, scarlet fever, subacute bacterial endocarditis, pneumococcal pneumonia, active tuberculosis, filariasis, typhus, trypanosomiasis disease, relapsing fever, leptospirosis, malaria, but the low titer, in 1:8 following general, when using serum antigen spiral of FTA-ABS or TPHA test, serum negative reaction. PCR negative.

2. Chronic biological false positive, and sustainable for more than 6 months or a few years or even for life, can be divided into two categories:

(1) non-spiral of serum antigen test false positive; these diseases common in autoimmune diseases such as systemic lupus erythematosus, disseminated discoid lupus erythematosus, autoimmune hemolytic anemia, and systemic sclerosis, rheumatoid arthritis, rheumatic heart disease, cirrhosis, nodular more arteritis, Sjogren’s syndrome, chronic glomerulonephritis and heroin addiction, titer up to 1:64 ~ 1:128; minority pregnant women, the normal crowd false positive rate of 1% -2%. In over 70 years old in one percent false positive.

(2) antigen in serum spiral false positive rate than non-spiral of serum antigen test less, although some other disease patients FTA-ABS false positive, the staining was often weak or non-typical “beaded - like.”

(3) serum syphilis false negative reaction

1. A syphilis hard chancre:: General hard chancre: in 2-3 weeks, before a reaction of the body, so early response negative serum.

2. Immediate treatment of syphilis infection or advanced syphilis: Because of low serum response, a negative.

3. Secondary syphilis false negative; less than 1% of the patients with secondary syphilis not diluted its serum VDRL test were negative or weakly positive reaction, but in a highly diluted as positive, that is, before the band phenomenon (Prozone phenomenon), it is serum anticardiolipin antibodies in excess inhibit positive results.

4. Technical operations or antigen in serum low-sensitivity test negative.

Eyelid Vaccinia the diagnosis and treatment

[Diagnosis]
1. History often Vaccinia vaccine vaccinia vaccine or eyelid skin splash into history.
2. Obviously eyelid redness, and there Vaccinia-like pustules, pustular pierced forming ulcers, skin healing callus appeared, after forming a permanent scar.
3. A small number of cases, secondary Vaccinia conjunctivitis or keratitis.
[Treatment]
Treatment of herpes zoster and basically the same.

Eyelid skin disease
According to the eyelid common causes of skin disease can be divided into:
Bacterial infection of the eyelid skin: ① erysipelas, caused by streptococcus infection subcutaneous tissue inflammation, and more involvement on the lower eyelid at the same time, the primary infection rare, facial or more since spread from nearby organizations. fever, quality hard, smooth surface, congestive was bright red lesions edge clear, with a high degree of swelling of the eyelids can not be opened, local pain and tenderness, swelling of submandibular lymph nodes often. ② pus cell disease, also known as septic callus measles, staphylococcus or streptococcus infection by the cause. Staphylococcus pustular disease for the easy proliferation of superficial suppurative skin infections, for the early cluster of yellow pustules, pustular rupture, the callus formed on the surface of pale yellow skin, Pustular streptococcus infection without disease characterized by the integration of erythema, a surface blisters, Rupture very thin-walled, easy adhesion formation of the yellow scab skin, the skin scab off easily without leaving scars. ③ unusual lupus, the skin for the most common form of tuberculosis. Often onset in childhood or infancy, in the beginning under the translucent skin and soft small nodules, a light red, yellow or brown red, nodules gradually increasing expansion and integration into a brown-red, to the visible glass pressure of brown powder in small point that the so-called “lupus nodules “Edge was irregular activities change, the central part of ulcer formation or scar. ④ furuncle swollen eyelids, occurred in the vicinity of the eyebrow. General Staphylococcus aureus infection of hair follicles caused inflammation of the mouth, followed far spread along the hair root of the formation of inflammatory sclerosis, congestive swelling of the skin, a few days later, the top of a sore filthy yellow-green pus suppository, eyelid swelling pain intensified, preauricular lymphadenopathy, the worse the temperature increased, with some pus toxicity phlebitis, thrombosis of the cavernous sinus phlebitis.
Virus infection of the eyelid skin diseases: multiple body from the bottom, according to clinical manifestations into vesicular, and the rash of new biotype. Common: ① herpes simplex, caused by the herpes simplex virus, with more body heat in STDs, can possibly complicated by the herpes simplex keratitis. ② herpes zoster, of the chickenpox? Herpes zoster virus, characterized by distribution along the trigeminal nerve (mostly first) with inflammation in the skin herpes generally confined to the side. ④ molluscum contagiosum. ⑤ other infections, such as smallpox, chicken pox, measles and other systemic diseases may occur in the eyelid with the same skin damage.
Fungal eyelid skin diseases: multiple by the scalp, face or other parts of the body from the spread, in the shallow - and deep-two. The superficial skin organized by various fungal infections of Trichophyton, the ball of spores, such as Candida caused. The Trichophyton for those infected with the most common skin psoriasis ring, the first to use red spots, gradually expanding to the surrounding form surrounded by edge brown yellow spots. Ball blister son of disease secondary to the more systemic infection, at the beginning, was micro-red skin nodules, can rupture the pus from the rich fungus, and ultimately the development of ulcerative Chenghua pyogenic granuloma block. Violations of the conjunctiva and deep organizations such as cryptococcal fungi, Candida albicans, bacteria and spores silk Actinomyces by the face and other parts of the body from expansion.
Allergic eyelid skin disease: more concerned with the systemic immune mechanism. The most common have eczema, urticaria, contact dermatitis, psoriasis, erythema multiforme and other allergic eyelid skin.